Order Kazusa clone(s) from : ![]() |
Product ID | ORK00226 |
---|---|
Accession No | AB037811 |
Description | family with sequence similarity 63, member A, transcript variant 1 |
Clone name | hh08938 |
Vector information | |
cDNA sequence | DNA sequence (5222 bp) Predicted protein sequence (505 aa) |
Flexi ORF Clone | FXC00226 |
Source | Human adult brain |
Rouge ID |
mKIAA1390
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3659 bp |
---|---|
Genome contig ID | gi89161185r_149132310 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 149232310 | 149241870 | 10 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | GATAGGGTTCAAGGTTGTGTG |
---|---|
Primer_r | AGCAATGTTTCAGCCTAAGGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GATAGGGTTCAAGGTTGTGTG |
Primer_r | AGCAATGTTTCAGCCTAAGGG |
PCR product length | 116 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |