Order Kazusa clone(s) from : ![]() |
Product ID | ORK00130 |
---|---|
Accession No | AB018345 |
Description | microtubule crosslinking factor 1 |
Clone name | hh07536 |
Vector information | |
cDNA sequence | DNA sequence (6009 bp) Predicted protein sequence (1578 aa) |
Flexi ORF Clone | FXC00130 |
Source | Human adult brain |
Rouge ID |
mKIAA0802
by Kazusa Mouse cDNA Project
|
Note | We replaced hh01783, former representative clones for KIAA0802 with hh07536. (1999/6/16) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1189 bp |
---|---|
Genome contig ID | gi51511735f_8597409 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (225368 - 225417) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 18 | f | 8697409 | 8822775 | 15 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Primer_f | TATACCGCTACTGTGTCCTCG |
---|---|
Primer_r | TCATACAGACCCAGAGGCATC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTTCATCACGGTCTCATACAG |
Primer_r | CGATGATCCAACAGCAACACC |
PCR product length | 167 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |