KIAA1542

Product ID	ORK00860
Accession No	AB040975
Description	PHD and ring finger domains 1, transcript variant 2
Clone name	hh03408
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5521 bp) Predicted protein sequence (1654 aa)
HaloTag ORF Clone	FHC00860
Flexi ORF Clone	FXC00860
Source	Human adult brain
Rouge ID	mKIAA1542 by Kazusa Mouse cDNA Project

Length: 5521 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	443 bp
Genome contig ID	gi51511727f_466523
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCTGAATTAGGAATATCTTTACTTTCTCTTTTCC
Flanking genome sequence (135699 - 135748)	----+--------+--------+--------+--------+----* AATTATGTTGTGCTCTTGTAAATAATTGCTCGAGTTTGCACTCAACACCG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	566486	602220	18	99.9	Perfect prediction

Length: 1654 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX02353	99.9	CTD-binding SR-...	Homo sapiens
AAI44294	99.8	PHRF1 protein [...	Homo sapiens
AAI44296	99.7	PHRF1 protein [...	Homo sapiens
AAI44295	99.7	PHRF1 protein [...	Homo sapiens
XP_508199	96.9	CTD-binding SR-...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028942	0.00046	26.7	KIAA1019
AB002322	0.00057	24.2	KIAA0324

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	113	153	PF00097	Zinc finger
HMMPfam	IPR001965	190	238	PF00628	Zinc finger
HMMSmart	IPR001841	113	153	SM00184	Zinc finger
	IPR001965	190	236	SM00249	Zinc finger
	IPR001841	191	235	SM00184	Zinc finger
ProfileScan	IPR001841	113	154	PS50089	Zinc finger
ProfileScan	IPR001965	188	238	PS50016	Zinc finger
ScanRegExp	IPR001841	131	140	PS00518	Zinc finger
ScanRegExp	IPR001965	159	235	PS01359	Zinc finger

Primer_f	ACAGTGACAGCGAGCATGGAG
Primer_r	GCCTGGTCTCTGAATGCGTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCAAGAGTGGAGAGATCAACC
Primer_r	GCGCATGTGCCTGTACTTGTC
PCR product length	78 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles