Gene/Protein Characteristic Table for KIAA1049
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07077
Accession No AB028972
Description transcription factor 25 (basic helix-loop-helix)
Clone name hh02614a
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (1794 bp)
Predicted protein sequence (550 aa)
Source Human adult brain
Rouge ID mKIAA1049 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 1794 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 140 bp
Genome contig ID gi51511732f_88379756
PolyA signal sequence
(TATAAA,-18)
+----*----+----*----+----*----+----
TGGTCCACTGTTTCTCCTATAAATGTAAATGGGTC
Flanking genome sequence
(125533 - 125582)
----+----*----+----*----+----*----+----*----+----*
ACGCTCTGCCGTCCGCACCTTCTCCTTTCGCAGGCACTGAGCGCCGTCCC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 16 f 88478514 88505287 16 100.0 Perfect prediction
Features of the protein sequence
Description

Length: 550 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9BQ70 0 100.0 Transcription f...
Homo sapiens
XP_511180 0 99.6 NULP1 [Pan trog...
Pan troglodytes
EAW66677 0 99.8 NULP1, isoform ...
Homo sapiens
XP_001090795 0 96.2 similar to NULP...
Macaca mulatta
Q8R3L2 0 93.5 Transcription f...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006994 113 524 PF04910 Basic helix-loop-helix
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGACCGAAAAGCCGTATGATG
Primer_r TAGGAGAAACAGTGGACCAGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name GeneBridge 4
Primer_f TGACCGAAAAGCCGTATGATG
Primer_r TAGGAGAAACAGTGGACCAGG
PCR product length 111 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp