Order Kazusa clone(s) from : ![]() |
Product ID | ORK01638 |
---|---|
Accession No | AB058723 |
Description | retinoic acid induced 1 |
Clone name | hh01321 |
Vector information | |
cDNA sequence | DNA sequence (5915 bp) Predicted protein sequence (1644 aa) |
Flexi ORF Clone | FXC01638 |
Source | Human adult brain |
Rouge ID |
mKIAA1820
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 523 bp |
---|---|
Genome contig ID | gi51511734f_17425512 |
PolyA signal sequence (AGTAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (229932 - 229981) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | f | 17525512 | 17655442 | 4 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | CGCACCAAAACCCAGGAGATC |
---|---|
Primer_r | CTGGAGACCTTGAATGTGGCG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CGCACCAAAACCCAGGAGATC |
Primer_r | CTGGAGACCTTGAATGTGGCG |
PCR product length | 95 bp |
PCR conditions | 15 °C![]() ![]() ![]() ![]() |