Order Kazusa clone(s) from : ![]() |
Product ID | ORK00744 |
---|---|
Accession No | AB032955 |
Description | kelch-like family member 3, transcript variant 1 |
Clone name | hg04330 |
Vector information | |
cDNA sequence | DNA sequence (6573 bp) Predicted protein sequence (625 aa) |
Flexi ORF Clone | FXC00744 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 4595 bp |
---|---|
Genome contig ID | gi51511721r_136881090 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | r | 136981090 | 137099448 | 15 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR006651 | 478 | 491 | PR00501 | Kelch |
IPR006651 | 544 | 558 | PR00501 | Kelch | |
IPR006651 | 607 | 619 | PR00501 | Kelch | |
HMMPfam | IPR013069 | 78 | 185 | PF00651 | BTB/POZ |
IPR011705 | 190 | 292 | PF07707 | BTB/Kelch-associated | |
IPR006652 | 328 | 372 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 374 | 419 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 421 | 466 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 468 | 515 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 517 | 562 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 564 | 609 | PF01344 | Kelch repeat type 1 | |
HMMSmart | IPR000210 | 88 | 185 | SM00225 | BTB/POZ-like |
IPR006652 | 340 | 385 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 386 | 432 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 433 | 479 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 480 | 528 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 529 | 575 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 576 | 623 | SM00612 | Kelch repeat type 1 | |
ProfileScan | IPR000210 | 88 | 155 | PS50097 | BTB/POZ-like |
![]() |
Primer_f | CTGTGTTTCTACTGACCAAGC |
---|---|
Primer_r | ACTAGGGTGATTTGATGCTGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTGTGTTTCTACTGACCAAGC |
Primer_r | ACTAGGGTGATTTGATGCTGC |
PCR product length | 201 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |