KIAA0527

Product ID	ORK07030
Accession No	AB011099
Description	sushi domain containing 5
Clone name	hg02246
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5005 bp) Predicted protein sequence (768 aa)
Source	Human adult brain

Length: 5005 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2697 bp
Genome contig ID	gi89161205r_33066541
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CTTCTGAGATATTTAAAATAAATAATTATTGCCCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACAGTTGCTGAATGTATTTTATTTCTAGGCTACTGCACCAAGGTTTAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	33166541	33235711	5	99.2	Perfect prediction

Length: 768 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001173642	0	98.6	sushi domain co...	Pan troglodytes
XP_001098156	0	94.4	hypothetical pr...	Macaca mulatta
BAG58668	1.1e-213	100.0	unnamed protein...	Homo sapiens
O60279	9.2e-213	99.5	Sushi domain-co...	Homo sapiens
EAW64451	8.1e-191	95.5	hCG20070 [Homo ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000538	177	272	PF00193	Link
HMMSmart	IPR000538	176	273	SM00445	Link
ProfileScan	IPR000538	178	273	PS50963	Link
ProfileScan	IPR000436	277	338	PS50923	Sushi/SCR/CCP

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	710	SRGPVIATIVTVLCLLLLLAGVG	732	PRIMARY	23

Primer_f	CGCAACATGTTTTCTACCCTG
Primer_r	TCTTTGATTATGCTGCCTCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CGCAACATGTTTTCTACCCTG
Primer_r	TCTTTGATTATGCTGCCTCTC
PCR product length	93 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles