Order Kazusa clone(s) from : ![]() |
Product ID | ORK07030 |
---|---|
Accession No | AB011099 |
Description | sushi domain containing 5 |
Clone name | hg02246 |
Vector information | |
cDNA sequence | DNA sequence (5005 bp) Predicted protein sequence (768 aa) |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2697 bp |
---|---|
Genome contig ID | gi89161205r_33066541 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 33166541 | 33235711 | 5 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000538 | 177 | 272 | PF00193 | Link |
HMMSmart | IPR000538 | 176 | 273 | SM00445 | Link |
ProfileScan | IPR000538 | 178 | 273 | PS50963 | Link |
IPR000436 | 277 | 338 | PS50923 | Sushi/SCR/CCP |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 710 | SRGPVIATIVTVLCLLLLLAGVG | 732 | PRIMARY | 23 |
---|
![]() |
---|
Primer_f | CGCAACATGTTTTCTACCCTG |
---|---|
Primer_r | TCTTTGATTATGCTGCCTCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CGCAACATGTTTTCTACCCTG |
Primer_r | TCTTTGATTATGCTGCCTCTC |
PCR product length | 93 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |