|
Order Kazusa clone(s) from : |
| Product ID | ORK07635 |
|---|---|
| Accession No | AB011090 |
| Description | MGA, MAX dimerization protein |
| Clone name | hg01059 |
| Vector information | |
| cDNA sequence | DNA sequence (4617 bp) Predicted protein sequence (650 aa) |
| Source | Human adult brain |
Length: 4617 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Length: 650 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
RT-PCR
|
|---|
Experimental conditions| Primer_f | GCTTATTATCGCCGGACACAC |
|---|---|
| Primer_r | TGCCTGATCTGTTAGTCCCTG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 15
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | GCTTATTATCGCCGGACACAC |
| Primer_r | TGCCTGATCTGTTAGTCCCTG |
| PCR product length | 172 (1.2k) bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |