KIAA0262

Product ID	ORK00482
Accession No	D87451
Description	ring finger protein 10
Clone name	ha07073s1
Vector information	The cDNA fragment was originally inserted at the EcoRV-NotI ... The cDNA fragment was originally inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) without using any linker or adapter and a RT-PCR product (1-180) was subcloned upstream of the cDNA (181-2657). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CGGTATCGAT AAGCTT-5' end of cDNA.
cDNA sequence	DNA sequence (2657 bp) Predicted protein sequence (811 aa)
HaloTag ORF Clone	FHC00482
Flexi ORF Clone	FXC00482
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0262 by Kazusa Mouse cDNA Project
Note	We replaced ha07073, former representative clones for KIAA0262 with ha07073s1. (2002/5/10)

Length: 2657 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	221 bp
Genome contig ID	gi89161190f_119356998
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGTCTTTACACCAAAATAAAGTATTGACACAAGAG
Flanking genome sequence (142077 - 142126)	----+--------+--------+--------+--------+----* ATCTCTTCCTGCCAAGGTTTTTAGTTCATTGCCAGTTTAGTCTTTTTGAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	119456998	119499073	17	100.0	Perfect prediction

Length: 811 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAP36359	100.0	ring finger pro...	synthetic construct
AAH31596	99.9	Ring finger pro...	Homo sapiens
BAG53531	99.9	unnamed protein...	Homo sapiens
BAG52797	99.9	unnamed protein...	Homo sapiens
BAG63094	99.9	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	225	266	PF00097	Zinc finger
HMMSmart	IPR001841	225	266	SM00184	Zinc finger
ProfileScan	IPR001841	225	266	PS50089	Zinc finger
ScanRegExp	IPR001841	240	249	PS00518	Zinc finger

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TTTCCCCCATGCTTTTGTTTG
Primer_r	ATTTTCTTGGTTCCCCCTCAC
PCR product length	108 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles