Order Kazusa clone(s) from : ![]() |
Product ID | ORK07141 |
---|---|
Accession No | D87446 |
Description | transmembrane protein 131 |
Clone name | ha07065 |
Vector information | |
cDNA sequence | DNA sequence (6178 bp) Predicted protein sequence (1805 aa) |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0257
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 759 bp |
---|---|
Genome contig ID | gi89161199r_97639235 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 97739235 | 97891602 | 39 | 99.9 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1040 | LALYIIISGIMSALFLLVIGTAY | 1062 | PRIMARY | 23 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | CATGAGATTTGCTGTTGTGCT |
Primer_r | ATAAAGCATGGGGAAGACAGG |
PCR product length | 125 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |