Order Kazusa clone(s) from : ![]() |
Product ID | ORK00491 |
---|---|
Accession No | D87468 |
Description | activity-regulated cytoskeleton-associated protein |
Clone name | ha06634 |
Vector information | |
cDNA sequence | DNA sequence (2935 bp) Predicted protein sequence (460 aa) |
HaloTag ORF Clone |
FHC00491
![]() |
Flexi ORF Clone | FXC00491 |
Source | Human adult brain |
Rouge ID |
mKIAA0278
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1551 bp |
---|---|
Genome contig ID | gi51511724r_143589412 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | r | 143689412 | 143692815 | 3 | 99.0 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | GACAAGTCTTCAGCCCACACC |
Primer_r | AGGTTTCCAGGGTCTTCACAG |
PCR product length | 126 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |