Order Kazusa clone(s) from : ![]() |
Product ID | ORK00458 |
---|---|
Accession No | D86962 |
Description | growth factor receptor-bound protein 10 |
Clone name | ha02795 |
Vector information | |
cDNA sequence | DNA sequence (5431 bp) Predicted protein sequence (605 aa) |
Flexi ORF Clone | FXC00458 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0207
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2883 bp |
---|---|
Genome contig ID | gi89161213r_50525260 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | r | 50625260 | 50828160 | 18 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000980 | 504 | 600 | PD000093 | SH2 motif |
FPrintScan | IPR000980 | 504 | 518 | PR00401 | SH2 motif |
IPR000980 | 525 | 535 | PR00401 | SH2 motif | |
IPR000980 | 574 | 588 | PR00401 | SH2 motif | |
HMMPfam | IPR000159 | 177 | 261 | PF00788 | Ras-association |
IPR001849 | 302 | 410 | PF00169 | Pleckstrin-like | |
IPR015042 | 434 | 483 | PF08947 | BPS (Between PH and SH2) | |
IPR000980 | 504 | 585 | PF00017 | SH2 motif | |
HMMSmart | IPR000159 | 177 | 261 | SM00314 | Ras-association |
IPR001849 | 302 | 412 | SM00233 | Pleckstrin-like | |
IPR000980 | 502 | 591 | SM00252 | SH2 motif | |
ProfileScan | IPR000159 | 177 | 261 | PS50200 | Ras-association |
IPR001849 | 301 | 410 | PS50003 | Pleckstrin-like | |
IPR000980 | 504 | 600 | PS50001 | SH2 motif |
Panel name | Genebridge 4 |
---|---|
Primer_f | TGCCAGACACTCCCAAATCCC |
Primer_r | AATCCGCGAGCCCTCAACTTG |
PCR product length | 120 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |