KIAA0227

Product ID	ORK01965
Accession No	D86980
Description	tetratricopeptide repeat domain 9
Clone name	ha02748
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5217 bp) Predicted protein sequence (336 aa)
HaloTag ORF Clone	FHC01965
Flexi ORF Clone	FXC01965
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0227 by Kazusa Mouse cDNA Project

Length: 5217 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	70178257	70211830	3	99.0	Perfect prediction

Length: 336 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001082201	1.3e-94	96.8	similar to Tetr...	Macaca mulatta
AAH47950	5e-81	100.0	TTC9 protein [H...	Homo sapiens
Q92623	2e-62	100.0	Tetratricopepti...	Homo sapiens
EAW81043	3.8e-62	99.5	hCG20925, isofo...	Homo sapiens
EDL02721	2.5e-53	78.7	mCG7933, isofor...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013105	278	311	PF07719	Tetratricopeptide TPR_2
HMMSmart	IPR013026	171	204	SM00028	Tetratricopeptide region
	IPR013026	242	277	SM00028	Tetratricopeptide region
	IPR013026	278	311	SM00028	Tetratricopeptide region
ProfileScan	IPR013026	242	311	PS50293	Tetratricopeptide region
ProfileScan	IPR013026	278	311	PS50005	Tetratricopeptide region

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CACATGTCTATAACGATTTCC
Primer_r	TGCAGGAAACAGGGTACTCTC
PCR product length	154 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles