KIAA0185

Product ID	ORK00034
Accession No	D80007
Description	programmed cell death 11
Clone name	ha02717
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5823 bp) Predicted protein sequence (1884 aa)
HaloTag ORF Clone	FHC00034
Flexi ORF Clone	FXC00034
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0185 by Kazusa Mouse cDNA Project

Length: 5823 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	167 bp
Genome contig ID	gi89161187f_105048162
PolyA signal sequence (None)	+--------+--------+----*----+---- ATCCTGTCAGGATGAAAAGGAAGTTGAGATTTTTT
Flanking genome sequence (147303 - 147352)	----+--------+--------+--------+--------+----* AAATCCCTCTTCGCTTGCTTTATTTTCAGTACCAACTTGTTATCTTTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	105146449	105195463	36	100.0	Perfect prediction

Length: 1884 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10300	100.0	RRP5 protein ho...	synthetic construct
Q14690	99.9	Protein RRP5 ho...	Homo sapiens
EAW49639	99.9	programmed cell...	Homo sapiens
EAW49640	99.3	programmed cell...	Homo sapiens
XP_001105950	97.2	programmed cell...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003029	462	535	PF00575	S1
	IPR003029	551	624	PF00575	S1
	IPR003029	738	811	PF00575	S1
	IPR003029	1045	1122	PF00575	S1
HMMSmart	IPR003029	94	184	SM00316	S1
	IPR003029	198	271	SM00316	S1
	IPR003029	292	359	SM00316	S1
	IPR003029	376	449	SM00316	S1
	IPR003029	464	535	SM00316	S1
	IPR003029	553	624	SM00316	S1
	IPR003029	647	720	SM00316	S1
	IPR003029	740	811	SM00316	S1
	IPR003029	857	924	SM00316	S1
	IPR003029	1047	1122	SM00316	S1
	IPR003029	1160	1235	SM00316	S1
	IPR003029	1241	1311	SM00316	S1
	IPR003029	1335	1409	SM00316	S1
	IPR003107	1613	1644	SM00386	RNA-processing protein
	IPR003107	1646	1683	SM00386	RNA-processing protein
	IPR003107	1685	1716	SM00386	RNA-processing protein
	IPR003107	1718	1750	SM00386	RNA-processing protein
	IPR003107	1752	1786	SM00386	RNA-processing protein
	IPR003107	1788	1820	SM00386	RNA-processing protein
	IPR003107	1822	1857	SM00386	RNA-processing protein
ProfileScan	IPR003029	96	184	PS50126	S1
	IPR003029	200	271	PS50126	S1
	IPR003029	294	359	PS50126	S1
	IPR003029	378	449	PS50126	S1
	IPR003029	466	535	PS50126	S1
	IPR003029	555	624	PS50126	S1
	IPR003029	649	720	PS50126	S1
	IPR003029	742	811	PS50126	S1
	IPR003029	1049	1122	PS50126	S1
	IPR003029	1162	1235	PS50126	S1
	IPR003029	1243	1311	PS50126	S1
	IPR003029	1337	1409	PS50126	S1
	IPR013026	1704	1807	PS50293	Tetratricopeptide region

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CATTTTTGAGAACACGCTGAG
Primer_r	TTCTCGTAGTCCAGGTAGCGC
PCR product length	183 (1.0k) bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles