Order Kazusa clone(s) from : ![]() |
Product ID | ORK00395 |
---|---|
Accession No | D31890 |
Description | lysyl-tRNA synthetase, transcript variant 2 |
Clone name | ha01530 |
Vector information | |
cDNA sequence | DNA sequence (1970 bp) Predicted protein sequence (601 aa) |
Flexi ORF Clone | FXC00395 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0070
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 162 bp |
---|---|
Genome contig ID | gi51511732r_74119132 |
PolyA signal sequence (ATTAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | r | 74219132 | 74239052 | 14 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002313 | 263 | 273 | PR00982 | Lysyl-tRNA synthetase |
IPR002313 | 279 | 295 | PR00982 | Lysyl-tRNA synthetase | |
IPR002313 | 308 | 321 | PR00982 | Lysyl-tRNA synthetase | |
IPR002313 | 326 | 343 | PR00982 | Lysyl-tRNA synthetase | |
IPR002313 | 462 | 478 | PR00982 | Lysyl-tRNA synthetase | |
HMMPfam | IPR004365 | 130 | 210 | PF01336 | Nucleic acid binding |
IPR004364 | 226 | 579 | PF00152 | Aminoacyl-tRNA synthetase | |
HMMTigr | IPR002313 | 76 | 581 | TIGR00499 | Lysyl-tRNA synthetase |
ProfileScan | IPR006195 | 248 | 579 | PS50862 | Aminoacyl-tRNA synthetase |
Panel name | Genebridge 4 |
---|---|
Primer_f | CTAAATGGCACCGCTCTAAAG |
Primer_r | TCAGTGGTTGCTACATTCTCC |
PCR product length | 340 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |