Order Kazusa clone(s) from : ![]() |
Product ID | ORK00382 |
---|---|
Accession No | D26362 |
Description | bromodomain containing 3 |
Clone name | ha01331 |
Vector information | |
cDNA sequence | DNA sequence (3028 bp) Predicted protein sequence (731 aa) |
Flexi ORF Clone | FXC00382 |
Source | Myeloblast cell line (KG-1) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 708 bp |
---|---|
Genome contig ID | gi89161216r_135787825 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | r | 135887825 | 135922913 | 12 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001487 | 59 | 72 | PR00503 | Bromodomain |
IPR001487 | 75 | 91 | PR00503 | Bromodomain | |
IPR001487 | 91 | 109 | PR00503 | Bromodomain | |
IPR001487 | 384 | 403 | PR00503 | Bromodomain | |
HMMPfam | IPR001487 | 44 | 133 | PF00439 | Bromodomain |
IPR001487 | 320 | 408 | PF00439 | Bromodomain | |
HMMSmart | IPR001487 | 37 | 147 | SM00297 | Bromodomain |
IPR001487 | 313 | 422 | SM00297 | Bromodomain | |
ProfileScan | IPR001487 | 56 | 128 | PS50014 | Bromodomain |
IPR001487 | 331 | 403 | PS50014 | Bromodomain | |
ScanRegExp | IPR001487 | 61 | 120 | PS00633 | Bromodomain |
IPR001487 | 336 | 395 | PS00633 | Bromodomain |
Panel name | Genebridge 4 |
---|---|
Primer_f | CGGACAGAACAGGACAGATGG |
Primer_r | GGGGTCATCGGGTTAGCATTT |
PCR product length | 271 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |