KIAA0056

Product ID	ORK06111
Accession No	D29954
Description	non-SMC condensin II complex, subunit D3
Clone name	ha01062
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5023 bp) Predicted protein sequence (1507 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0056 by Kazusa Mouse cDNA Project

Length: 5023 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	498 bp
Genome contig ID	gi51511727r_133427551
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GCTTTCTTAAAGTAATAAAGGTTTAGCATAAATAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCCTTCCAGTAGTCAATAGGATTTTTCTGTTTTTAGAACAGAGCTCTTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	133527551	133599058	35	99.8	Perfect prediction

Length: 1507 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_546388	82.3	similar to Holo...	Canis lupus fam...
AAI01929	74.8	Non-SMC condens...	Rattus norvegicus
Q6ZQK0	73.4	Condensin-2 com...	Mus musculus
NP_835214	73.3	non-SMC condens...	Mus musculus
EDL25317	73.4	RIKEN cDNA B130...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D63880	0.00015	22.8	KIAA0159

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	546	581	PF02985	HEAT
HMMPfam	IPR000357	982	1018	PF02985	HEAT

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	TCTCTGCATTCGCTACACCAT
Primer_r	GAGTGCTGACAAATCGGAAGA
PCR product length	173 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles