KIAA0076

Product ID	ORK00397
Accession No	D38548
Description	cullin 7, transcript variant 2
Clone name	ha00936
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5253 bp) Predicted protein sequence (1701 aa)
HaloTag ORF Clone	FHC00397
Flexi ORF Clone	FXC00397
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0076 by Kazusa Mouse cDNA Project

Length: 5253 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	70 bp
Genome contig ID	gi89161210r_43013334
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- GCTTTTACAGAAATTAAACCCAAGAGTTTGATTAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGACGTGTGTGTTTGGCGACTGCTAGAGATTTGAGTGGGGAGGTGGGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	43113334	43129415	26	99.7	Perfect prediction

Length: 1701 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH33647	100.0	Cullin 7 [Homo ...	Homo sapiens
Q14999	99.9	Cullin-7; Short...	Homo sapiens
BAF85495	99.9	unnamed protein...	Homo sapiens
XP_001136655	99.6	cullin 7 [Pan t...	Pan troglodytes
XP_001088003	97.2	cullin 7 [Macac...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014608	5.1e-181	62.2	KIAA0708
AB007859	4.7e-12	42.4	KIAA0399

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004939	815	997	PF03256	Anaphase-promoting complex subunit 10
HMMPfam	IPR001373	1046	1548	PF00888	Cullin
ProfileScan	IPR001373	1218	1509	PS50069	Cullin

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TTTGGTCAGCAGCCTTGGTAA
Primer_r	ATCTGTAGGGTATGGAAGGTG
PCR product length	219 bp
PCR conditions	95 °C15 sec65 °C120 sec32 cycles