Order Kazusa clone(s) from : ![]() |
Product ID | ORK01958 |
---|---|
Accession No | D14657 |
Description | KIAA0101, transcript variant 1 |
Clone name | ha00771 |
Vector information | |
cDNA sequence | DNA sequence (836 bp) Predicted protein sequence (130 aa) |
HaloTag ORF Clone |
FHC01958
![]() |
Flexi ORF Clone | FXC01958 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0101
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 439 bp |
---|---|
Genome contig ID | gi51511731r_62344843 |
PolyA signal sequence (ATTAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | r | 62444843 | 62460684 | 4 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | NULL | 20 | 130 | PD072652 | NULL |
Panel name | Genebridge 4 |
---|---|
Primer_f | TCAGTTCGTTCTCTCCTCTCC |
Primer_r | TAGTGGCAGAGGTGGAAGAAC |
PCR product length | 138 (0.4k) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |