Order Kazusa clone(s) from : ![]() |
Product ID | ORK00945 |
---|---|
Accession No | AB067486 |
Description | tubulin, gamma complex associated protein 5, transcript variant 1 |
Clone name | fk06803s1 |
Vector information | |
cDNA sequence | DNA sequence (3761 bp) Predicted protein sequence (1032 aa) |
Flexi ORF Clone | FXC00945 |
Source | Human fetal brain |
Rouge ID |
mKIAA1899
by Kazusa Mouse cDNA Project
|
Note | We replaced fk06803, former representative clones for KIAA1899 with fk06803s1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 642 bp |
---|---|
Genome contig ID | gi51511731f_20284923 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (140410 - 140459) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | f | 20384922 | 20425331 | 23 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | GAGGAACTTGCAGAAATTGAG |
---|---|
Primer_r | AGGGTGTTAAGCAGGTGAGAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |