KIAA1898

Product ID	ORK07009
Accession No	AB067485
Description	serine/threonine kinase 11 interacting protein
Clone name	fk06427
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3299 bp) Predicted protein sequence (1013 aa)
Source	Human fetal brain

Length: 3299 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	255 bp
Genome contig ID	gi89161199f_220074363
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTTTTCTCAGGTATCAATAAAGTTGTTTCCAACTC
Flanking genome sequence (115053 - 115102)	----+--------+--------+--------+--------+----* ATAGGTCATGTGTGGTACTTAGAGTCACTCATAAGGCCTGCAGTTCCCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	220174363	220189414	23	99.9	Perfect prediction

Length: 1013 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8N1F8	100.0	Serine/threonin...	Homo sapiens
AAL49726	99.9	LKB1-interactin...	Homo sapiens
NP_443134	99.9	LKB1 interactin...	Homo sapiens
AAH34051	99.6	Serine/threonin...	Homo sapiens
XP_001105761	94.4	similar to LKB1...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023192	0.0001	26.9	KIAA0975

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	136	149	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	178	191	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	180	203	PF00560	Leucine-rich repeat

Primer_f	GCTCCTTGATGTCTTGCAGTC
Primer_r	AAGGTAGAAGAACTGGCGAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-