|
Order Kazusa clone(s) from : |
| Product ID | ORK07606 |
|---|---|
| Accession No | AB058702 |
| Description | EF-hand calcium binding domain 7 |
| Clone name | fj20761 |
| Vector information | |
| cDNA sequence | DNA sequence (3973 bp) Predicted protein sequence (610 aa) |
| Source | Human fetal brain |
| Rouge ID |
mKIAA1799
by Kazusa Mouse cDNA Project
|
Length: 3973 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Length: 610 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR002048 | 107 | 170 | PD000012 | Calcium-binding EF-hand |
| HMMPfam | IPR002048 | 110 | 138 | PF00036 | Calcium-binding EF-hand |
| IPR002048 | 146 | 174 | PF00036 | Calcium-binding EF-hand | |
| IPR002048 | 411 | 432 | PF00036 | Calcium-binding EF-hand | |
| HMMSmart | IPR002048 | 110 | 138 | SM00054 | Calcium-binding EF-hand |
| IPR002048 | 146 | 174 | SM00054 | Calcium-binding EF-hand | |
| IPR002048 | 411 | 439 | SM00054 | Calcium-binding EF-hand | |
| ProfileScan | IPR002048 | 106 | 141 | PS50222 | Calcium-binding EF-hand |
| IPR002048 | 142 | 177 | PS50222 | Calcium-binding EF-hand | |
| IPR002048 | 407 | 442 | PS50222 | Calcium-binding EF-hand | |
| ScanRegExp | IPR002048 | 420 | 432 | PS00018 | Calcium-binding EF-hand |
RT-PCR-ELISA
|
Experimental conditions| Primer_f | AAGCTAATGATCGAGAAGGAG |
|---|---|
| Primer_r | ATTACTTTGGCATCACCGTTG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 1
Experimental conditions| Panel name | genbank |
|---|---|
| Primer_f | - |
| Primer_r | - |
| PCR product length | - |
| PCR conditions | - |