KIAA1699

Product ID	ORK04925
Accession No	AB051486
Description	exocyst complex component 4
Clone name	fj15278
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4132 bp) Predicted protein sequence (966 aa)
Source	Human fetal brain
Rouge ID	mKIAA1699 by Kazusa Mouse cDNA Project

Length: 4132 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1230 bp
Genome contig ID	gi89161213f_132488421
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- AAAAATGGAGAATTAAAAAGTGTTTTGAGAAGCTT
Flanking genome sequence (912632 - 912681)	----+--------+--------+--------+--------+----* AAATGTTTCATGTTATTTTTCTTGTGTTCTTTATTCAGCAAATATTCCCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	132588421	133401051	18	99.6	Perfect prediction

Length: 966 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96A65	100.0	Exocyst complex...	Homo sapiens
AAH67263	99.9	Exocyst complex...	Homo sapiens
XP_001139207	99.9	hypothetical pr...	Pan troglodytes
CAH90126	99.2	hypothetical pr...	Pongo abelii
XP_539369	96.9	similar to Exoc...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007191	1	136	PF04048	Sec8 exocyst complex component specific domain
ScanRegExp	IPR002464	181	190	PS00690	DNA/RNA helicase

Primer_f	AAGTCTTTTGATCCCAGTCCG
Primer_r	TTGCCTTTCATTCCTCCATAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-