KIAA1696

Product ID	ORK00889
Accession No	AB051483
Description	PHD finger protein 21A, transcript variant 2
Clone name	fj12768
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3675 bp) Predicted protein sequence (635 aa)
HaloTag ORF Clone	FHC00889
Flexi ORF Clone	FXC00889
Source	Human fetal brain
Rouge ID	mKIAA1696 by Kazusa Mouse cDNA Project

Length: 3675 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	1402 bp
Genome contig ID	gi51511727r_45810693
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- AACAGTGATTTCTATTAAAAAGGTGTCAGAACTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAAAATGCCGTGTAGTTATAATTTTTTAGCACAGACCCTGCTGATCACG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	45910693	46099305	18	100.0	Perfect prediction

Length: 635 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW68012	8.2e-188	100.0	PHD finger prot...	Homo sapiens
BAB14492	1.7e-187	99.8	unnamed protein...	Homo sapiens
XP_001112561	2.4e-187	99.5	similar to BRAF...	Macaca mulatta
XP_861897	1.7e-185	99.1	similar to BRAF...	Canis lupus fam...
XP_001251539	5.8e-183	97.5	similar to BRAF...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	445	490	PF00628	Zinc finger
HMMSmart	IPR001965	445	488	SM00249	Zinc finger
ProfileScan	IPR001965	443	490	PS50016	Zinc finger
ScanRegExp	IPR001965	446	487	PS01359	Zinc finger

Primer_f	ACAGCTCAGCAATTCCATAAG
Primer_r	TCAGAGTCTACAGGTTTGGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-