Order Kazusa clone(s) from : ![]() |
Product ID | ORK00253 |
---|---|
Accession No | AB046817 |
Description | synaptotagmin-like 2 |
Clone name | fj09819 |
Vector information | |
cDNA sequence | DNA sequence (4251 bp) Predicted protein sequence (913 aa) |
HaloTag ORF Clone |
FHC00253
![]() |
Flexi ORF Clone | FXC00253 |
Source | Human fetal brain |
Rouge ID |
mKIAA1597
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 912 bp |
---|---|
Genome contig ID | gi51511727r_84982975 |
PolyA signal sequence (AATAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | r | 85082975 | 85199826 | 20 | 99.6 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000008 | 640 | 652 | PR00360 | C2 calcium-dependent membrane targeting |
IPR000008 | 669 | 682 | PR00360 | C2 calcium-dependent membrane targeting | |
HMMPfam | IPR000008 | 624 | 713 | PF00168 | C2 calcium-dependent membrane targeting |
IPR000008 | 773 | 860 | PF00168 | C2 calcium-dependent membrane targeting | |
HMMSmart | IPR000008 | 623 | 728 | SM00239 | C2 calcium-dependent membrane targeting |
IPR000008 | 772 | 875 | SM00239 | C2 calcium-dependent membrane targeting | |
ProfileScan | IPR010911 | 4 | 60 | PS50916 | Rab-binding |
IPR000008 | 623 | 713 | PS50004 | C2 calcium-dependent membrane targeting | |
IPR000008 | 772 | 860 | PS50004 | C2 calcium-dependent membrane targeting |
![]() |
Primer_f | ACTGAAGTGGACTGGATGGAC |
---|---|
Primer_r | TTCAAGATCAGATTCCACCGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | ACTGAAGTGGACTGGATGGAC |
Primer_r | TTCAAGATCAGATTCCACCGG |
PCR product length | 192 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |