KIAA1864

Product ID	ORK05476
Accession No	AB058767
Description	HYDIN, axonemal central pair apparatus protein
Clone name	fj07836
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4599 bp) Predicted protein sequence (660 aa)
Source	Human fetal brain

Length: 4599 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	909 bp
Genome contig ID	gi51511732r_69385229
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTCAGCAACAGAGCGAGACCCTGTCTC
Flanking genome sequence (99711 - 99662)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGAAAAGAAAAGAAAAGAAAAAGTAACACAAAATCAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	r	69484940	69565334	20	99.0	Perfect prediction

Length: 660 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL11459	4.5e-165	73.7	mCG132588 [Mus ...	Mus musculus
EDL92538	8.6e-165	73.1	rCG51059 [Rattu...	Rattus norvegicus
XP_511085	2.8e-148	86.8	similar to hydr...	Pan troglodytes
Q4G0P3	4.5e-148	86.8	Hydrocephalus-i...	Homo sapiens
XP_001498384	2.2e-120	68.7	hydrocephalus i...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	TCGGTTGGAGGTTTTAGATGC
Primer_r	CGCGATCTCATATTTCCCACG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. "1,16"

Experimental conditions

Panel name	CCR
Primer_f	ACAGACCTGGACAACTTCAAC
Primer_r	GTATGGGTAAGTGCAGATGCC
PCR product length	95 bp
PCR conditions	15 °C64 sec60 °C30 sec216(400) cycles