KIAA1381

Gene/Protein Characteristic Table for KIAA1381

Order Kazusa clone(s) from :

Product ID	ORK04599
Accession No	AB037802
Description	component of oligomeric golgi complex 1
Clone name	fj05335
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4052 bp) Predicted protein sequence (961 aa)
Source	Human fetal brain
Rouge ID	mKIAA1381 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4052 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1165 bp
Genome contig ID	gi51511734f_68600806
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TCTCCCTAAATAAATACTACCACATTATTTCTTCT
Flanking genome sequence (115434 - 115483)	----+--------+--------+--------+--------+----* AAAGGTGCCTCTGCTCATCTGATTCTCAGCCACACCAATCTTTCCAGTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	68700806	68716238	13	99.6	Perfect prediction

Features of the protein sequence

Description

Length: 961 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW89113	99.9	component of ol...	Homo sapiens
XP_001086484	98.2	similar to comp...	Macaca mulatta
BAG72502	100.0	component of ol...	synthetic construct
Q8WTW3	99.9	Conserved oligo...	Homo sapiens
AAH47465	99.4	COG1 protein [H...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GTGTATCCTTTCCGTATTCCC
Primer_r	TGTGGGCAGAACTGAAAGATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 17

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp