ROUGE

Gene/Protein Characteristic Table for mKIAA1381

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220387
Description :	Conserved oligomeric Golgi complex component 1.
Clone Name :	mfj18313 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 5136 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2749 bp

Genome contig ID gi65527427f_113370626
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
CCTGGGCACAACACATTAAAGGTGAGAGAAGAAAC
Flanking genome sequence
(114534 - 114583)
----+----*----+----*----+----*----+----*----+----*
AACCCCCAAAAAGTGTATCTTGAAATGCCATAAATGGTTACTGTATGCAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1381 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1381	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1097, 1185..2192, 2538..3323
Length: 963 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Z160	99.3	Conserved oligo...	Mus musculus
BAE35130	99.2	unnamed protein...	Mus musculus
BAE37141	99.2	unnamed protein...	Mus musculus
AAD13780	99.2	ldlBp [Mus musc...	Mus musculus
EDL34410	98.2	component of ol...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2749 bp
Genome contig ID	gi65527427f_113370626
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- CCTGGGCACAACACATTAAAGGTGAGAGAAGAAAC
Flanking genome sequence (114534 - 114583)	----+--------+--------+--------+--------+----* AACCCCCAAAAAGTGTATCTTGAAATGCCATAAATGGTTACTGTATGCAG

Gene/Protein Characteristic Table for mKIAA1381

Features of the cloned DNA sequence

Features of the protein sequence