KIAA1037

Product ID	ORK07362
Accession No	AB028960
Description	WD and tetratricopeptide repeats 1
Clone name	fh02134
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5091 bp) Predicted protein sequence (488 aa)
Source	Human fetal brain

Length: 5091 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3623 bp
Genome contig ID	gi89161185f_27386787
PolyA signal sequence (AATATA,-21)	+--------+--------+----*----+---- TTACATTGTGACCCAATATACACATGATTACTTGT
Flanking genome sequence (120855 - 120904)	----+--------+--------+--------+--------+----* AGATATGTGTGTGTGTATATATATATAAAAAAAATGAACAAAAGTTTTAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	27486787	27507640	10	99.5	Perfect prediction

Length: 488 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX07772	0	100.0	WD and tetratri...	Homo sapiens
EAX07769	3.9e-197	97.8	WD and tetratri...	Homo sapiens
XP_001147927	1.3e-196	100.0	WD and tetratri...	Pan troglodytes
Q8N5D0	1.5e-196	100.0	WD and tetratri...	Homo sapiens
BAA91868	1.6e-196	97.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018262	8e-07	28.7	KIAA0719

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	15	54	PF00400	WD40 repeat
	IPR001440	253	286	PF00515	Tetratricopeptide TPR_1
	IPR001440	287	323	PF00515	Tetratricopeptide TPR_1
HMMSmart	IPR013026	253	286	SM00028	Tetratricopeptide region
	IPR013026	287	323	SM00028	Tetratricopeptide region
	IPR013026	324	357	SM00028	Tetratricopeptide region
ProfileScan	IPR001680	1	63	PS50294	WD40 repeat
ProfileScan	IPR013026	253	357	PS50293	Tetratricopeptide region

Primer_f	GCCCTCTAAATGTCAGTGGTG
Primer_r	ATATAGCCCTGGTCACTGTTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGAAGACAAGTGGAGGGTGAG
Primer_r	GAGAAAGGTCACGGAGAAGAG
PCR product length	231 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles