KIAA0226

Product ID	ORK00036
Accession No	D86979
Description	RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein, transcript variant 1
Clone name	fg02838
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5396 bp) Predicted protein sequence (973 aa)
HaloTag ORF Clone	FHC00036
Flexi ORF Clone	FXC00036
Source	Human fetal brain
Rouge ID	mKIAA0226 by Kazusa Mouse cDNA Project
Note	We replaced ha04633, former representative clones for KIAA0226 with fg02838. (2001/10/06)

Length: 5396 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2377 bp
Genome contig ID	gi89161205r_198783253
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TAATAAACTAAGGAAATAAAATTCTGTCTTTCGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCCTGCCTTGACTGTCAAGAAATGGCATGTGTCCACTGTAAAGCAGGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	198883253	198960656	22	99.8	Perfect prediction

Length: 973 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001926534	2e-189	91.5	similar to CG12...	Sus scrofa
BAC26925	1.3e-175	84.0	unnamed protein...	Mus musculus
BAC31257	1.4e-175	84.0	unnamed protein...	Mus musculus
XP_001373567	1.7e-175	81.1	similar to hCG2...	Monodelphis dom...
AAH57307	2.5e-175	85.5	1700021K19Rik p...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002354	2.2e-12	22.7	KIAA0356

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR004012	108	168	SM00593	RUN
ProfileScan	IPR004012	34	175	PS50826	RUN

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CGTTCTCTGCCAAGGATTTAG
Primer_r	AGATGACAATGAACTGCCAGG
PCR product length	149 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles