Order Kazusa clone(s) from : ![]() |
Product ID | ORK05074 |
---|---|
Accession No | AK024493 |
Clone name | as00098 |
Vector information | |
cDNA sequence | DNA sequence (4318 bp) Predicted protein sequence (780 aa) |
Source | Human spleen |
Rouge ID |
mFLJ00098
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004841 | 1 | 393 | PF00324 | Amino acid permease-associated region |
ProfileScan | IPR002293 | 117 | 294 | PS50285 | Amino acid/polyamine transporter I |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 60 | EIQGIPGAASGVFLENLWSTYAH | 82 | SECONDARY | 23 | 2 | 108 | YVLTDIAASFTLLVGIYFPSVTG | 130 | SECONDARY | 23 | 3 | 153 | ILAIVTTSFIYLSCIVLFGACIE | 175 | PRIMARY | 23 | 4 | 190 | NLVIGMLAWPSPWVIVIGSFFST | 212 | SECONDARY | 23 | 5 | 252 | TWALLLTVLICETGILIASLDSV | 274 | PRIMARY | 23 | 6 | 278 | LSMFFLMCYLFVNLACAVQTLLR | 300 | PRIMARY | 23 | 7 | 319 | GMSLCLALMFICSWYYALSAMLI | 341 | PRIMARY | 23 |
---|
![]() |
Primer_f | AGGTTGTCCATAAAGAGGTTG |
---|---|
Primer_r | AAACATCTGGGGGCACAAGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |