|
Order Kazusa clone(s) from : |
| Product ID | ORK05074 |
|---|---|
| Accession No | AK024493 |
| Clone name | as00098 |
| Vector information | |
| cDNA sequence | DNA sequence (4318 bp) Predicted protein sequence (780 aa) |
| Source | Human spleen |
| Rouge ID |
mFLJ00098
by Kazusa Mouse cDNA Project
|
Length: 4318 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Length: 780 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR004841 | 1 | 393 | PF00324 | Amino acid permease-associated region |
| ProfileScan | IPR002293 | 117 | 294 | PS50285 | Amino acid/polyamine transporter I |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 60 | EIQGIPGAASGVFLENLWSTYAH | 82 | SECONDARY | 23 | 2 | 108 | YVLTDIAASFTLLVGIYFPSVTG | 130 | SECONDARY | 23 | 3 | 153 | ILAIVTTSFIYLSCIVLFGACIE | 175 | PRIMARY | 23 | 4 | 190 | NLVIGMLAWPSPWVIVIGSFFST | 212 | SECONDARY | 23 | 5 | 252 | TWALLLTVLICETGILIASLDSV | 274 | PRIMARY | 23 | 6 | 278 | LSMFFLMCYLFVNLACAVQTLLR | 300 | PRIMARY | 23 | 7 | 319 | GMSLCLALMFICSWYYALSAMLI | 341 | PRIMARY | 23 |
|---|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | AGGTTGTCCATAAAGAGGTTG |
|---|---|
| Primer_r | AAACATCTGGGGGCACAAGTG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |