|
Order Kazusa clone(s) from : |
| Product ID | ORK04859 |
|---|---|
| Accession No | AK024451 |
| Clone name | as00043 |
| Vector information | |
| cDNA sequence | DNA sequence (4421 bp) Predicted protein sequence (1415 aa) |
| Source | Human spleen |
| Rouge ID |
mFLJ00043
by Kazusa Mouse cDNA Project
|
Length: 4421 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Length: 1415 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR001715 | 931 | 1034 | PF00307 | Calponin-like actin-binding |
| HMMSmart | IPR001715 | 931 | 1029 | SM00033 | Calponin-like actin-binding |
| ProfileScan | NULL | 453 | 782 | PS50313 | NULL |
| IPR001715 | 929 | 1031 | PS50021 | Calponin-like actin-binding | |
| IPR000694 | 1208 | 1239 | PS50099 | Proline-rich region |
RT-PCR-ELISA
|
Experimental conditions| Primer_f | CCCGAGCATTGAGGATAAAGG |
|---|---|
| Primer_r | TTGACAAACTGCTGAACTCTC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |