KIAA1858

Product ID	ORK05723
Accession No	AB058761
Description	zinc finger protein 469
Clone name	ae00147
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (8855 bp) Predicted protein sequence (2469 aa)
Source	Human brain (amygdala)
Rouge ID	mKIAA1858 by Kazusa Mouse cDNA Project
Note	We replaced fh12352, former representative clones for KIAA1858 with ae00147. (2005/08/06)

Length: 8855 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1443 bp
Genome contig ID	gi51511732f_86925830
PolyA signal sequence (AATATA,-24)	+--------+--------+----*----+---- TTGTCTTTTCAAATATATTCCCACTATTTTCGCAG
Flanking genome sequence (108830 - 108879)	----+--------+--------+--------+--------+----* AAAACCTCCAGCTGCGTGACGTCTGTCCTCCCGCCGGCCCCCATCCCTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	87025830	87034658	2	99.0	Internal No-hit

Length: 2469 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96JG9	0	99.8	Zinc finger pro...	Homo sapiens
XP_523457	0	97.2	zinc finger pro...	Pan troglodytes
XP_001098268	0	88.2	zinc finger pro...	Macaca mulatta
EAW66812	2.7e-215	99.9	hCG1979743, iso...	Homo sapiens
XP_546786	2.8e-177	50.1	similar to Zinc...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	1631	1653	PF00096	Zinc finger
	IPR007087	1853	1875	PF00096	Zinc finger
	IPR007087	1934	1956	PF00096	Zinc finger
HMMSmart	IPR015880	988	1011	SM00355	Zinc finger
	IPR015880	1631	1653	SM00355	Zinc finger
	IPR015880	1659	1683	SM00355	Zinc finger
	IPR015880	1691	1713	SM00355	Zinc finger
	IPR015880	1853	1875	SM00355	Zinc finger
	IPR015880	1881	1904	SM00355	Zinc finger
	IPR015880	1934	1956	SM00355	Zinc finger
ProfileScan	IPR007087	1631	1658	PS50157	Zinc finger
	IPR007087	1853	1880	PS50157	Zinc finger
	IPR007087	1934	1963	PS50157	Zinc finger
ScanRegExp	IPR007087	990	1011	PS00028	Zinc finger
	IPR007087	1633	1653	PS00028	Zinc finger
	IPR007087	1693	1713	PS00028	Zinc finger
	IPR007087	1855	1875	PS00028	Zinc finger
	IPR007087	1883	1904	PS00028	Zinc finger
	IPR007087	1936	1956	PS00028	Zinc finger

Primer_f	GCAGCCCTTTTGAGACCACAC
Primer_r	CAACAGCAGCAAGACTAAGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCAGCCCTTTTGAGACCACAC
Primer_r	CAACAGCAGCAAGACTAAGAG
PCR product length	95 bp
PCR conditions	15 °C64 sec60 °C30 sec222 cycles