KIAA1980

Product ID	ORK07238
Accession No	AB075860
Description	tetratricopeptide repeat domain 14
Clone name	fj10323s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2419 bp) Predicted protein sequence (660 aa)
Source	Human fetal brain
Rouge ID	mKIAA1980 by Kazusa Mouse cDNA Project
Note	We replaced fj10323, former representative clones for KIAA1980 with fj10323s1. (2002/12/27)

Length: 2419 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	436 bp
Genome contig ID	gi89161205f_181703650
PolyA signal sequence (ATTAAA,-28)	+--------+--------+----*----+---- CTGTTAAATTAAAAATCGTCAGCTTTTGAAAGATT
Flanking genome sequence (107812 - 107861)	----+--------+--------+--------+--------+----* ATATGTTCGAATGTTTCTTGAACACTTTTATATTTATCAGTTTAAATATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	181803650	181811460	10	100.0	Perfect prediction

Length: 660 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96N46	2.6e-209	100.0	Tetratricopepti...	Homo sapiens
XP_001495821	1.7e-195	93.7	tetratricopepti...	Equus caballus
XP_001927220	9.8e-191	92.3	tetratricopepti...	Sus scrofa
XP_535814	1.6e-185	90.0	similar to tetr...	Canis lupus fam...
XP_848442	1.6e-185	90.0	similar to tetr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013105	197	230	PF07719	Tetratricopeptide TPR_2
	IPR001440	231	264	PF00515	Tetratricopeptide TPR_1
	IPR001440	272	305	PF00515	Tetratricopeptide TPR_1
HMMSmart	IPR013026	197	230	SM00028	Tetratricopeptide region
	IPR013026	231	264	SM00028	Tetratricopeptide region
	IPR013026	272	305	SM00028	Tetratricopeptide region
ProfileScan	IPR003029	16	98	PS50126	S1
	IPR013026	197	230	PS50005	Tetratricopeptide region
	IPR013026	197	305	PS50293	Tetratricopeptide region
	IPR013026	231	264	PS50005	Tetratricopeptide region
	IPR013026	272	305	PS50005	Tetratricopeptide region

Primer_f	TAGCCCACTTAGAAATCACAG
Primer_r	TGGAAGAGAAGAGCTATACAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-