KIAA1802

Product ID	ORK00922
Accession No	AB058705
Description	chromosome alignment maintaining phosphoprotein 1, transcript variant 1
Clone name	fj21631
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3555 bp) Predicted protein sequence (821 aa)
HaloTag ORF Clone	FHC00922
Flexi ORF Clone	FXC00922
Source	Human fetal brain
Rouge ID	mKIAA1802 by Kazusa Mouse cDNA Project

Length: 3555 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1040 bp
Genome contig ID	gi51511729f_114007344
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- GTATCAACCAAATTAAAAAGAAAGGTTTTCATGTC
Flanking genome sequence (103556 - 103605)	----+--------+--------+--------+--------+----* AGCAACATCTTCATGTGTGTTTTCTTTTGTGTAGTTTTCATTGTATGATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	f	114107344	114110898	1	100.0	Perfect prediction

Length: 821 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001089737	1e-190	97.7	similar to F35A...	Macaca mulatta
BAC11273	5.9e-176	99.6	unnamed protein...	Homo sapiens
EDM08915	1e-119	77.1	rCG43039, isofo...	Rattus norvegicus
Q8K327	1.2e-119	76.0	Zinc finger pro...	Mus musculus
BAE21972	6.9e-119	75.7	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	NULL	152	168	PR01217	NULL
	NULL	185	197	PR01217	NULL
	NULL	203	224	PR01217	NULL
	NULL	232	248	PR01217	NULL
	NULL	253	270	PR01217	NULL
HMMPfam	IPR007087	747	769	PF00096	Zinc finger
HMMSmart	IPR015880	23	46	SM00355	Zinc finger
	IPR015880	71	94	SM00355	Zinc finger
	IPR015880	718	741	SM00355	Zinc finger
	IPR015880	747	769	SM00355	Zinc finger
	IPR015880	774	795	SM00355	Zinc finger
ProfileScan	IPR007087	747	769	PS50157	Zinc finger
ScanRegExp	IPR007087	749	769	PS00028	Zinc finger

Primer_f	AATAGTTTGCAGCCTTCTCCC
Primer_r	AAGATACAGAATGGAAGACTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-