KIAA1753

Product ID	ORK00911
Accession No	AB051540
Description	unkempt family zinc finger, transcript variant 1
Clone name	pj02614
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3839 bp) Predicted protein sequence (818 aa)
HaloTag ORF Clone	FHC00911
Flexi ORF Clone	FXC00911
Source	Human brain (hippocampus)
Rouge ID	mKIAA1753 by Kazusa Mouse cDNA Project

Length: 3839 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1381 bp
Genome contig ID	gi51511734f_71192532
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GCTCCAAACCTATTGGAAATAAAATATGAACTTGC
Flanking genome sequence (140944 - 140993)	----+--------+--------+--------+--------+----* AGTGGTAGCTTGTTTACATGGGGGTGAGGGGGAGTGGGTCCCAAAAGAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	71292532	71333474	16	99.9	Perfect prediction

Length: 818 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001073888	100.0	zinc finger CCC...	Homo sapiens
Q9C0B0	100.0	RING finger pro...	Homo sapiens
XP_001492089	98.3	unkempt homolog...	Equus caballus
AAI26634	97.5	Unkempt homolog...	Bos taurus
EDL34547	95.5	zinc finger CCC...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000571	93	120	PF00642	Zinc finger
	IPR000571	133	161	PF00642	Zinc finger
	IPR000571	224	248	PF00642	Zinc finger
	IPR000571	302	328	PF00642	Zinc finger
HMMSmart	IPR000571	93	120	SM00356	Zinc finger
	IPR000571	132	161	SM00356	Zinc finger
	IPR000571	223	248	SM00356	Zinc finger
	IPR000571	259	292	SM00356	Zinc finger
	IPR000571	301	328	SM00356	Zinc finger

Primer_f	CCGGAAGCACAAATACAGGTC
Primer_r	CTTGGTGGACTTGTAGATCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-