KIAA1745

Product ID	ORK06762
Accession No	AB051532
Description	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
Clone name	pj01678
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3766 bp) Predicted protein sequence (893 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1745 by Kazusa Mouse cDNA Project

Length: 3766 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1015 bp
Genome contig ID	gi51511731f_88445578
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GTCATTTTTTAATAAAGTCTGAAGAATTACTGTTT
Flanking genome sequence (128318 - 128367)	----+--------+--------+--------+--------+----* AATCCTGGCTCTTCCTCTTCAAGGACAGTTGCTTTTTGAGGTAGGTCTAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	88545578	88573894	14	100.0	Perfect prediction

Length: 893 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001096618	96.7	semaphorin 4B [...	Macaca mulatta
BAG11357	100.0	semaphorin-4B p...	synthetic construct
AAQ88758	99.9	semaphorin C [H...	Homo sapiens
BAF82680	99.8	unnamed protein...	Homo sapiens
Q9NPR2	100.0	Semaphorin-4B; ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051526	2.6e-60	40.3	KIAA1739
AB046839	5.7e-52	38.5	KIAA1619
AB002329	9.8e-29	30.6	KIAA0331
AB040878	3.8e-16	33.1	KIAA1445
AB037789	7.4e-16	32.5	KIAA1368

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001627	126	563	PF01403	Semaphorin/CD100 antigen
HMMPfam	IPR002165	581	633	PF01437	Plexin
HMMSmart	IPR001627	126	563	SM00630	Semaphorin/CD100 antigen
HMMSmart	IPR003659	581	635	SM00423	Plexin/semaphorin/integrin
ProfileScan	IPR001627	103	579	PS51004	Semaphorin/CD100 antigen

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	772	KEFLVMCTLFVLAVLLPVLFLLY	794	PRIMARY	23

Primer_f	CAATGTACGCCTTTCCCTCAG
Primer_r	GCAGTTAGTTCCTCGTGTTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-