Order Kazusa clone(s) from : ![]() |
Product ID | ORK00266 |
---|---|
Accession No | AB051472 |
Description | additional sex combs like transcriptional regulator 2 |
Clone name | pf04287 |
Vector information | |
cDNA sequence | DNA sequence (7174 bp) Predicted protein sequence (1505 aa) |
HaloTag ORF Clone |
FHC00266
![]() |
Flexi ORF Clone | FXC00266 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1685
by Kazusa Mouse cDNA Project
|
Note | We replaced fh25856, former representative clones for KIAA1685 with pf04287. (2001/2/07) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 2645 bp |
---|---|
Genome contig ID | gi89161199r_25715757 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 25815757 | 25954816 | 12 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Primer_f | CGCCTTCGAAATGTTACTGCC |
---|---|
Primer_r | CTCTTTCTAGTCTCATTACCG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |