KIAA1627

Product ID	ORK00881
Accession No	AB046847
Description	methyltransferase like 14
Clone name	hh13711s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326GW (Amp-r) vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. The original pYO326 shuttle vector (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (2109 bp) Predicted protein sequence (468 aa)
HaloTag ORF Clone	FHC00881
Flexi ORF Clone	FXC00881
Source	Human adult brain
Rouge ID	mKIAA1627 by Kazusa Mouse cDNA Project
Note	We replaced hh13711, former representative clones for KIAA1627 with hh13711s1. (2002/5/10)

Length: 2109 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	618 bp
Genome contig ID	gi89161207f_119726018
PolyA signal sequence (None)	+--------+--------+----*----+---- GGTGAAAGAAGAGATAGAACTTAGCAGGCAGACTT
Flanking genome sequence (125507 - 125556)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGTTTATCATCATAATCTCAATTTTGTGGCTATGAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	119826018	119851523	11	99.6	Perfect prediction

Length: 468 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001098431	8e-171	99.6	similar to CG78...	Macaca mulatta
AAH52204	2.3e-168	98.5	RIKEN cDNA G430...	Mus musculus
XP_545043	1.8e-163	95.9	similar to CG78...	Canis lupus fam...
XP_001512394	7.2e-159	95.2	hypothetical pr...	Ornithorhynchus...
BAG58819	5.8e-144	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007757	198	375	PF05063	MT-A70
ProfileScan	IPR007757	159	395	PS51143	MT-A70

Primer_f	GTGAACAGAATGGAACAACTC
Primer_r	CTCTATTCTATCAAGGCCCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	RH-map
Primer_f	GTGAACAGAATGGAACAACTC
Primer_r	CTCTATTCTATCAAGGCCCTG
PCR product length	167 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles