KIAA1591

Product ID	ORK04422
Accession No	AB046811
Description	Ca++-dependent secretion activator 2
Clone name	fj09118
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3821 bp) Predicted protein sequence (1018 aa)
Source	Human fetal brain

Length: 3821 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	762 bp
Genome contig ID	gi89161213r_121646689
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AACAGCTTGCAGGCAATAAAAATCTATTTGCTCAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTACTTCTGTATTTATTAGACTTATATAGAGCAAATGCAGTAAAAGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	121746689	122090603	25	99.5	Perfect prediction

Length: 1018 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI44279	100.0	Ca++-dependent ...	Homo sapiens
XP_001146172	99.9	Ca2+-dependent ...	Pan troglodytes
XP_001146755	99.9	Ca2+-dependent ...	Pan troglodytes
AAN38707	99.9	CADPS2 [Homo sa...	Homo sapiens
BAG54341	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032947	3.7e-183	75.8	KIAA1121

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	130	210	PF00168	C2 calcium-dependent membrane targeting
	IPR001849	251	353	PF00169	Pleckstrin-like
	IPR010439	560	651	PF06292	Protein of unknown function DUF1041
HMMSmart	IPR001849	251	355	SM00233	Pleckstrin-like
ProfileScan	IPR001849	250	353	PS50003	Pleckstrin-like
ProfileScan	IPR014770	642	773	PS51258	Munc13 homology 1

Primer_f	TGCACCAACACTGTCGTATCC
Primer_r	GTTTGGCAATCCTTTCATCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-