KIAA1383

Product ID	ORK00819
Accession No	AB037804
Description	microtubule-associated protein 10
Clone name	fj06145
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4904 bp) Predicted protein sequence (907 aa)
HaloTag ORF Clone	FHC00819
Flexi ORF Clone	FXC00819
Source	Human fetal brain
Rouge ID	mKIAA1383 by Kazusa Mouse cDNA Project

Length: 4904 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2179 bp
Genome contig ID	gi89161185f_230907812
PolyA signal sequence (None)	+--------+--------+----*----+---- TAAAATTATTGAAACATGAAATAGTATTTCAAGTC
Flanking genome sequence (104905 - 104954)	----+--------+--------+--------+--------+----* ACAAATAAGGGAGACTGTCATTTCATTGTAAAACCAAGCTATTGCAAACC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	231007812	231012715	1	99.0	Perfect prediction

Length: 907 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_061963	0	100.0	hypothetical pr...	Homo sapiens
XP_001104413	0	91.7	hypothetical pr...	Macaca mulatta
XP_001916667	4.9e-208	66.5	hypothetical pr...	Equus caballus
XP_001925574	2.5e-157	65.7	hypothetical pr...	Sus scrofa
BAC37814	3.7e-53	48.7	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	GAAATCCCAGAGGCACAGAAG
Primer_r	ATTTCTCCCATTGCCAGCACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 1

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GAAATCCCAGAGGCACAGAAG
Primer_r	ATTTCTCCCATTGCCAGCACC
PCR product length	132 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles