KIAA1358

Product ID	ORK05655
Accession No	AB037779
Description	tectonin beta-propeller repeat containing 1
Clone name	fj02029
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4183 bp) Predicted protein sequence (1123 aa)
Source	Human fetal brain
Rouge ID	mKIAA1358 by Kazusa Mouse cDNA Project

Length: 4183 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	809 bp
Genome contig ID	gi89161213r_97584112
PolyA signal sequence (None)	+--------+--------+----*----+---- CTGCACTCCAGCCTGGGCGACAGAGACTCCATCTC
Flanking genome sequence (99715 - 99666)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAGTGAAGGAAGGAGACAGCAGATTGGAAATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	97683827	97713270	24	99.8	Perfect prediction

Length: 1123 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF85685	99.7	unnamed protein...	Homo sapiens
XP_001135397	96.5	similar to DKFZ...	Pan troglodytes
XP_001135239	95.4	similar to DKFZ...	Pan troglodytes
EAW76716	100.0	DKFZP434B0335 p...	Homo sapiens
XP_546986	87.9	similar to CG32...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002295	7.3e-07	30.1	KIAA0297
AB002327	7.8e-07	30.1	KIAA0329
AB040972	0.00031	23.5	KIAA1539

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	781	874	PD718531	NULL
HMMPfam	IPR006624	167	198	PF06462	Beta-propeller repeat TECPR
	IPR006624	212	243	PF06462	Beta-propeller repeat TECPR
	IPR006624	259	290	PF06462	Beta-propeller repeat TECPR
	IPR006624	302	334	PF06462	Beta-propeller repeat TECPR
	IPR006624	687	714	PF06462	Beta-propeller repeat TECPR
	IPR006624	911	942	PF06462	Beta-propeller repeat TECPR
	IPR006624	956	987	PF06462	Beta-propeller repeat TECPR
	IPR006624	1002	1033	PF06462	Beta-propeller repeat TECPR
	IPR006624	1045	1085	PF06462	Beta-propeller repeat TECPR
HMMSmart	IPR006613	22	83	SM00693	Dysferlin
	IPR006614	95	128	SM00694	Dysferlin
	IPR006624	150	183	SM00706	Beta-propeller repeat TECPR
	IPR006624	192	228	SM00706	Beta-propeller repeat TECPR
	IPR006624	237	275	SM00706	Beta-propeller repeat TECPR
	IPR006624	284	319	SM00706	Beta-propeller repeat TECPR
	IPR006624	664	703	SM00706	Beta-propeller repeat TECPR
	IPR006624	719	753	SM00706	Beta-propeller repeat TECPR
	IPR006613	774	835	SM00693	Dysferlin
	IPR006614	846	879	SM00694	Dysferlin
	IPR006624	893	927	SM00706	Beta-propeller repeat TECPR
	IPR006624	936	972	SM00706	Beta-propeller repeat TECPR
	IPR006624	981	1018	SM00706	Beta-propeller repeat TECPR
	IPR006624	1027	1062	SM00706	Beta-propeller repeat TECPR

Primer_f	GACAGCATCCTCTTCATCTAC
Primer_r	AGTCATTCATGTCCTGCTCGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GACAGCATCCTCTTCATCTAC
Primer_r	AGTCATTCATGTCCTGCTCGG
PCR product length	193(600) bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles