KIAA1257

Product ID	ORK00783
Accession No	AB033083
Description	KIAA1257
Clone name	hh15604
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6035 bp) Predicted protein sequence (465 aa)
HaloTag ORF Clone	FHC00783
Flexi ORF Clone	FXC00783
Source	Human adult brain

Length: 6035 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4637 bp
Genome contig ID	gi89161205r_130068403
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGCAGCAGAGCAAGACTCTGTCTC
Flanking genome sequence (99719 - 99670)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAGAAAAAGCATTCTGACAGCTCTGACAGCTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	130168122	130195648	8	99.2	Perfect prediction

Length: 465 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW79291	1.1e-177	100.0	hCG20001, isofo...	Homo sapiens
XP_001094939	2.3e-169	93.0	hypothetical pr...	Macaca mulatta
EAW79290	1.5e-151	100.0	hCG20001, isofo...	Homo sapiens
XP_001914892	2.5e-94	62.2	hypothetical pr...	Equus caballus
EDK99216	2.3e-75	55.1	mCG130866 [Mus ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	TAGCTTTTACCAGTCCACGAG
Primer_r	GATGAGGACTCGATGCTGCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 3

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TAGCTTTTACCAGTCCACGAG
Primer_r	GATGAGGACTCGATGCTGCTG
PCR product length	111 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles