Order Kazusa clone(s) from : ![]() |
Product ID | ORK02022 |
---|---|
Accession No | AB033052 |
Description | neurolysin (metallopeptidase M3 family) |
Clone name | fh04414s1 |
Vector information | |
cDNA sequence | DNA sequence (6113 bp) Predicted protein sequence (704 aa) |
HaloTag ORF Clone |
FHC02022
![]() |
Flexi ORF Clone | FXC02022 |
Source | Human fetal brain |
Rouge ID |
mKIAA1226
by Kazusa Mouse cDNA Project
|
Note | We replaced fh04414, former representative clones for KIAA1226 with fh04414s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3998 bp |
---|---|
Genome contig ID | gi51511721f_64953957 |
PolyA signal sequence (AATAAA,-8) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (204540 - 204589) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 65053957 | 65158495 | 13 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TAGAGAGCCATGGGAAGAGAG |
---|---|
Primer_r | ATCACCAGACAGAACAGGCTA |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |