KIAA1212

Product ID	ORK04462
Accession No	AB033038
Description	coiled-coil domain containing 88A
Clone name	fh00638s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5515 bp) Predicted protein sequence (802 aa)
Source	Human fetal brain
Rouge ID	mKIAA1212 by Kazusa Mouse cDNA Project
Note	We replaced fh00638, former representative clones for KIAA1212 with fh00638s1. (2002/5/10)

Length: 5515 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3104 bp
Genome contig ID	gi89161199r_55268730
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- ACTTATAACTGTTATTAAATACCAAATCAAATAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATAAAAGCTGTAACATTTCCTTTAAAACTAATGCTAATAAGGGATTTAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	55368730	55403184	15	99.4	Terminal No-hit

Length: 802 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF44475	99.6	PKB/Akt-binding...	Homo sapiens
CAD98038	99.5	hypothetical pr...	Homo sapiens
CAI46020	99.2	hypothetical pr...	Homo sapiens
XP_852258	95.6	similar to Hook...	Canis lupus fam...
XP_001917582	95.5	coiled-coil dom...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040942	1.2e-38	37.6	KIAA1509

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	CTTATGCAACTTTACCTCGTG
Primer_r	TTAGATGCTGCAGTGGTGTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTTATGCAACTTTACCTCGTG
Primer_r	TTAGATGCTGCAGTGGTGTTG
PCR product length	160 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles