Order Kazusa clone(s) from : ![]() |
Product ID | ORK00104 |
---|---|
Accession No | AB011162 |
Description | intraflagellar transport 140 |
Clone name | hj02755 |
Vector information | |
cDNA sequence | DNA sequence (4962 bp) Predicted protein sequence (1468 aa) |
Flexi ORF Clone |
FXC00104
![]() |
Source | Human adult brain |
Rouge ID |
mKIAA0590
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001680 | 99 | 137 | PF00400 | WD40 repeat |
HMMSmart | IPR001680 | 61 | 95 | SM00320 | WD40 repeat |
IPR001680 | 97 | 137 | SM00320 | WD40 repeat | |
IPR001680 | 320 | 358 | SM00320 | WD40 repeat | |
ProfileScan | IPR001680 | 63 | 146 | PS50294 | WD40 repeat |
IPR001680 | 105 | 146 | PS50082 | WD40 repeat |
![]() |
---|
Primer_f | CATGTCTGTGTTGGAATACGC |
---|---|
Primer_r | GAATACGATGGAAGGGTGAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CATGTCTGTGTTGGAATACGC |
Primer_r | GAATACGATGGAAGGGTGAAC |
PCR product length | 178 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |