Order Kazusa clone(s) from : ![]() |
Product ID | ORK06453 |
---|---|
Accession No | AB032983 |
Description | protein phosphatase, Mg2+/Mn2+ dependent, 1H |
Clone name | hh05862 |
Vector information | |
cDNA sequence | DNA sequence (5791 bp) Predicted protein sequence (428 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1157
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4504 bp |
---|---|
Genome contig ID | gi89161190r_61224066 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99967 - 99918) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | r | 61324033 | 61512313 | 9 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR014045 | 24 | 400 | PF00481 | Protein phosphatase 2C |
HMMSmart | IPR001932 | 14 | 419 | SM00332 | Protein phosphatase 2C-related |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 179 | ISGGCTALIVICLLGKLYVANAG | 201 | PRIMARY | 23 |
---|
![]() |
Primer_f | TTAGAACAAACTCAGTCCGTC |
---|---|
Primer_r | CAAGAACAGCAGATAGGTATG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |