Order Kazusa clone(s) from : ![]() |
Product ID | ORK00736 |
---|---|
Accession No | AB029012 |
Description | SMG5 nonsense mediated mRNA decay factor |
Clone name | ha02541 |
Vector information | |
cDNA sequence | DNA sequence (4563 bp) Predicted protein sequence (1033 aa) |
HaloTag ORF Clone |
FHC00736
![]() |
Flexi ORF Clone | FXC00736 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA1089
by Kazusa Mouse cDNA Project
|
Note | We replaced hk03401, former representative clones for KIAA1089 with ha02541. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1361 bp |
---|---|
Genome contig ID | gi89161185r_154385641 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 154485641 | 154519233 | 22 | 99.6 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMSmart | IPR006596 | 872 | 995 | SM00670 | Nucleotide binding protein |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 365 | AFLPDLLIFQMVIICLMCVHSLE | 387 | PRIMARY | 23 |
---|
![]() |
Primer_f | GGAGCAGAGATCATGAATAGC |
---|---|
Primer_r | GCCAACTATCCTCTAAGCCAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGAGCAGAGATCATGAATAGC |
Primer_r | GCCAACTATCCTCTAAGCCAC |
PCR product length | 211 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |