Gene/Protein Characteristic Table for KIAA1064
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01623
Accession No AB028987
Description Zinc finger CCCH domain-containing protein 4
Clone name hj05008s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
ORF sequence DNA sequence (6115 bp)
Protein sequence (1315 aa)
Flexi ORF Clone FXC01623
Source Human adult brain
Rouge ID mKIAA1064 by Kazusa Mouse cDNA Project
Note We replaced hj05008, former representative clones for KIAA1064 with hj05008s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 6115 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 2165 bp
Genome contig ID gi42406306r_52159289
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
ATTGTATTACTGCCATTAAAGGATGCAGTTATTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAGCTTGTGGGTCTGGTCTCTCCAGGCTGCCCCAGACCATCCCTTGC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 r 52259289 52308849 15 99.3 Perfect prediction
Features of the protein sequence
Description

Length: 1315 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9UPT8 0 100.0 Zinc finger CCC...
Homo sapiens
XP_001109916 0 98.5 similar to Zinc...
Macaca mulatta
XP_599954 0 92.8 similar to zinc...
Bos taurus
Q6ZPZ3 0 90.7 Zinc finger CCC...
Mus musculus
XP_001053214 0 90.1 similar to Zinc...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB111887 1.1e-17 34.0 KIAA2035
AB032998 0.00094 23.8 KIAA1172
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000571 403 428 PF00642 Zinc finger
IPR000571 432 457 PF00642 Zinc finger
IPR000571 459 481 PF00642 Zinc finger
HMMSmart IPR000571 403 428 SM00356 Zinc finger
IPR000571 432 457 SM00356 Zinc finger
IPR000571 458 481 SM00356 Zinc finger
Expression profile
Description

RT-PCR-ELISA

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp