KIAA1040

Product ID	ORK00169
Accession No	AB028963
Description	MON2 homolog, regulator of endosome-to-Golgi trafficking, transcript variant 1
Clone name	hh15271
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6387 bp) Predicted protein sequence (1736 aa)
HaloTag ORF Clone	FHC00169
Flexi ORF Clone	FXC00169
Source	Human adult brain
Rouge ID	mKIAA1040 by Kazusa Mouse cDNA Project
Note	We replaced fh02456 and fh02456s1, former representative clones for KIAA1040 with hh15271. (2002/5/10,2002/5/10)

Length: 6387 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	871 bp
Genome contig ID	gi89161190f_61046896
PolyA signal sequence (None)	+--------+--------+----*----+---- CATACCTCATTTCTTTAAACAGCTCTCCAAGCTTT
Flanking genome sequence (226773 - 226822)	----+--------+--------+--------+--------+----* CACTGAAGTCTGTCTGTTTTTTATATTGGCTGTCTGGATTTTAAAGACTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	61146896	61273667	35	99.9	Perfect prediction

Length: 1736 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q7Z3U7	100.0	Protein MON2 ho...	Homo sapiens
XP_001165756	99.9	homolog of yeas...	Pan troglodytes
NP_055841	99.9	MON2 homolog [H...	Homo sapiens
BAC11707	99.9	SF21 protein [H...	Homo sapiens
XP_001165820	99.8	homolog of yeas...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR015403	866	951	PF09324	Protein of unknown function DUF1981
HMMPfam	IPR000357	1159	1195	PF02985	HEAT

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	571	MVNACWCGLLAALSLLLDASTDE	593	PRIMARY	23

Primer_f	GTTAATTATCCCTCCCATCAG
Primer_r	TTCTTGGCAGCTGTTGTTGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GTTAATTATCCCTCCCATCAG
Primer_r	TTCTTGGCAGCTGTTGTTGGC
PCR product length	146 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles